Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A061C01
Clone ID A061C01
Vector pT1betageo
Project ggtc

Sequence tag A061C01
Sequence
CCGAGCTAGCGCGACGAGGCCGCCTCTATGGTCTTCCTCTCCTTCTGGAGTCGGGAAATGGCCGCTGTGTAGTTAGCACG
GAGGTAAACCCTGCACGCACATCGTGNNTCGGCGTGTCAG
Sequence Type mRNA
Unitrap ID UNI374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 20032291..20032410 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037608 (Bclaf1) NM_001025393 BCL2-associated transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1917580]

 
Come back to gene ENSMUSG00000037608


For any suggestions or comments, please send an email to unitrap@crg.es