Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A061A07
Clone ID A061A07
Vector pT1betageo
Project ggtc

Sequence tag A061A07
Sequence
AGGGCGAGTGTGAGCAAACCCCTGAGGAGCTGGAGCCAGTTGAGAAGCAGGGCGTGGATGACATTGAGAAGTTTGAAGAT
GAAGGAGCTGGTTTTGAAGAATCCTCAGAGACCGGAGACTACGAAGAGAAGGCGGAAACTGAGGAGGCTGAGGAACCGGA
AGAGGACGGGGAAGACAATGCGAGCGGGAGTGCCTCTAAGCACAGCCCCACAGAAGATGACGAAAGCGCAAAGGCTGAGG
CGGACGTGCACCTCAAGGAGAAGAGGGAGTCTGTGGTCAGTGGTGACGACCGGGCGGAAGAAGACATGGATGATGTGCTT
GAGAAAGGAGAAGCTGAACAGTCTGAGGAAGAGGGCGAAGAGGAGGACAAAGCAGAGGATGCCAGAGAGGAAGGCTATGA
GCCCGACAAAACTGAGGCTGAGGATTATGTGATGGCCGTGGCTGACAAGGCGTCTAGGCTGCAGTCACATAGGAGCA
Sequence Type mRNA
Unitrap ID UNI8355

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 100202994..100203471 468
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052727 (Mtap1b) NM_008634 microtubule-associated protein 1B Gene [Source:MGI Symbol;Acc:MGI:1306778]

 
Come back to gene ENSMUSG00000052727


For any suggestions or comments, please send an email to unitrap@crg.es