Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14865G4
Clone ID IST14865G4
Vector VICTR76
Project tigm

Sequence tag IST14865G4HMF1
Sequence
CCCCCCAGACTGCCAGAGAAAGATGACTCANCAGATAAAGGGCATGCTGCTCAAGCCTAACCAGAATTCTTGGTGAAAAG
AGAAACAGCCAACGATCACAGACTGCAGCTGAAAAGCATGCCCGTNCGGTGGTACACTGGTGGTACATACCTTTAATCCC
ANCACTCNNGAGGAANANGCAGGTGGATCACTGNGTTNNNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14865G4HMR1
Sequence
AAAAGATTTACCTAGTTTATTATGTACATGGGTGTTTCACCTGAATCTGTGTCTGTGCACCATCTATGTANCACCCGCAN
AAGTCAGAAGAAAGTCATCCCCAAGAACTAGAGTCACAGGCAACTGTTAAGCCATCTTGTGTTCTGGAAATCAAATTCTG
GTCCCCTGGAANAGCANCCNNTGCTGATGTTGTTGTTTTGTTTGCTNGTTTGN
Sequence Type genomic DNA
Unitrap ID UNI13985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17193881..17194092 198
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038965 (Ube2l3) NM_009456 ubiquitin-conjugating enzyme E2L 3 Gene [Source:MGI (curated);Acc:Ube2l3-001]

 
Come back to gene ENSMUSG00000038965


For any suggestions or comments, please send an email to unitrap@crg.es