Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10977B7
Clone ID IST10977B7
Vector VICTR76
Project tigm

Sequence tag IST10977B7HMR1
Sequence
GACGAAGTAACATCTGCCCACTGGGATTTTCTTAAGGGTTAAATGAGACTCTGCAGACTCAAGCCATCACAAAAAAGCCA
NTGTA
Sequence Type genomic DNA
Unitrap ID UNI32801

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106520492..106520575 82
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]


Sequence tag IST10977B7HMF1
Sequence
GTCATTTTCACTATCATTATCATCACTATCACCACCATCGCCATCATTATCCGCATCACCACTACCATCACCATTTCTAC
TTTACAGGCAGTGGTGCTTAGGTTTGAGGAAGTCACCCACAAGAAGATTGTAGAAGTGGGACCCCGTTCTTCAGCAGCAG
CCTCAGCCCCACTCCTGAGCAGGTCCTGTGACAACTCATCTCCCTGCTGGTCCTGGGGAGTGGGGAAGGGACCCCATCAC
TGACACTGTCTTGTTCCCAACCGGTAAGAGTCAGGGGTTCTGCCCACCATCTGGAGACCTTCGCATAGGTCCAGATTCGA
GCTCTTTCTTTTAAGCACAGGGTGTTCTCTTCNNCGTTATCTGTCTGCGTGGGCNACAAACCCGGTTNATAAACAAGGCA
AAAAATGGCAAGAGGAAAAAGTGAAGTCNGCCTGTGCCATTGGAGCAAGTCAAACAATACCAAGCTCGTAGCTGGCTNAG
TGGCTGTCTCATTGTCCAGATATTTCCTCNGGCNNTTAAACAAGCGAGGAATGATTGCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106520573..106521110 520
 
EST/CDNA Est Name
  CB587554.1 - CF173393.1 - CF914469.1 - BG080354.2 - CD550310.1 - BU697042.1 - AI510163.1 - BU695300.1 - AA088034.1 - CD742108.1 - AA110123.1 - AA867567.1 - BE289940.1 - DT915366.1 - W18943.1 - AA462321.1 - AI323278.1 - AA124630.1 - CD550246.1

 
Come back to gene CB587554.1 - CF173393.1 - CF914469.1 - BG080354.2 - CD550310.1 - BU697042.1 - AI510163.1 - BU695300.1 - AA088034.1 - CD742108.1 - AA110123.1 - AA867567.1 - BE289940.1 - DT915366.1 - W18943.1 - AA462321.1 - AI323278.1 - AA124630.1 - CD550246.1


For any suggestions or comments, please send an email to unitrap@crg.es