Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W221A03
Clone ID W221A03
Vector ROSAbetageo
Project ggtc

Sequence tag W221A03
Sequence
AGGCTCAGGTACGCCTGCCGGGAGGGCCCCTCACCTAAAGTCGTGGAGGGGGCAGACCTCGCTACTGGGCTTTCCGACGC
CTGCCTATAAGCTCTGCCCCTAGCAAACAAAGATGCCGGGCGGGGTCTCTGATACCCCTTCCCAAAG
Sequence Type mRNA
Unitrap ID UNI12044

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75495471..75495819 73
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049764 (Zfp280b) NM_177475 zinc finger protein 280b Gene [Source:MGI Symbol;Acc:MGI:1927865]

 
Come back to gene ENSMUSG00000049764


For any suggestions or comments, please send an email to unitrap@crg.es