Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12770E5
Clone ID IST12770E5
Vector VICTR76
Project tigm

Sequence tag IST12770E5BBF1
Sequence
GAAATACATAGGAAGCCTACTGCATATTTGTTTGATCTGTATAAGCAGAAAAATTCTCAAACAAATGAAAGAAAGGCTAC
ATTAGATCGTGGTAAACAGCCAAATGAAAGAAAGGCTACATTAGATCGTGGTAAACAGCAATCTCGGCCAGTGAATCAAT
TTCCAGACTTGAGACAGTTTGCAGATCCGGAACCCCTTGAATGAAGGGGTGGCCAGGTTCCGCTGAGGAAGGATCTTGAT
AAGACACTCAAAGGTTTTGCTGTTACCCTTTCTCCAGTTCTTCCCCANANGGACCTACGGCCTTTTACAAGGGTAACTGT
ACACTGGGGAAAAGGAAATAATCAGACTTTTCGGGGTCTGCTGGATACTGGTTCTGANTTGACACTGATCCCAGGGGATC
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 36090368..36090767 394
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7527536..7527935 394
NO GENE  


Sequence tag IST12770E5HMF1
Sequence
GAAATACATAGGAAGCCTACTGCATATTTGTTTGATCTGTATAAGCAGAAAAATTCTCAAACAAATGAAAGAAAGGCTAC
ATTAGATCGTGGTAAACAGCCAAATGAAAGAAAGGCTACATTAGATCGTGGTAAACAGCAATCTCGGCCAGTGAATCAAT
TTCCAGACTTGAGACAGTTTGCAGATCCGGAACCCCTTGAATGAAGGGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI10157

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 13125806..13126017 212
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 100120938..100121149 212
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 7527536..7527747 212
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 45307025..45307236 212
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 152091145..152091356 212
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074698 (Csnk2a1) NM_007788 casein kinase 2, alpha 1 polypeptide Gene [Source:MGI (curated);Acc:Csnk2a1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 36090368..36090579 212
NO GENE  

 
Come back to gene ENSMUSG00000074698


For any suggestions or comments, please send an email to unitrap@crg.es