Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14691H2
Clone ID IST14691H2
Vector VICTR76
Project tigm

Sequence tag IST14691H2HMF1
Sequence
AAGGCAATGTTGAAATTAGCTTTTATGGTAGGATATACATTTCCAGGTTCCCAGAAAGATAGGTCCTTCCAAAAGTGTCT
CTGATGTTTGTCATTATGAAGCTAAACCAAACGCAACTCTTAATCTCACAGGCGCGAGCTTCATTTCTTCGGGGTGAAGG
TCAGCATCATTGAGCCAGGGAACTACAAGACATCCATTCTGGGCCAAGAAGCTCTGGAATCACGCATGAAGAAGCTGTGG
GATCGGCTGCCACAGGANACCCGGGATAGCTACGGAGAGGAGTATTTCCAAACCTGTGAGTCTCCANGCAGACNTGGGCT
CTCTGANGAAGAGCTGGGGGTTTGGGGTCNNTN
Sequence Type genomic DNA
Unitrap ID UNI32803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127340503..127340851 341
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040127 (Sdro) NM_027301 retinol dehydrogenase 20 Gene [Source:MGI Symbol;Acc:MGI:1917311]


Sequence tag IST14691H2BBF1
Sequence
AAGGCAATGTTGAAATTAGCTTTTATGGTAGGATATACATTTCCAGGTTCCCAGAAAGATAGGTCCTTCCAAAAGTGTCT
CTGATGTTTGTCATTATGAAGCTAAACCAAACGCAACTCTTAATCTCACAGGCGCGAGCTTCATTTCTTCGGGGTGAAGG
TCAGCATCATTGAGCCAGGGAACTACAAGACATCCATTCTGGGCCAAGAAGCTCTGGAATCACGCATGAAGAAGCTGTGG
GATCGGCTGCCACAGGAGACCCGGGATAGCTACGGAGAGGAGTATTTCCAAACCTGTGAGTCTCCAGGCAGACGTGGGCT
CTCTGANGAAGAGCTGGGGGTTTGGGGTCNCTGGCTGGATGATGACGTACAGCCCCAGAGATCATGCATACAGTTAGGAG
CAAAGTCNGAGTTTGAGATTAGAGCCCACGTTGCAGANCNACAGTGTANGGGNANGGTANGCTGTGTGGGGGACNCTGCC
TGCNCNNGN
Sequence Type genomic DNA
Unitrap ID UNI32803

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 127340503..127340984 461
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040127 (Sdro) NM_027301 retinol dehydrogenase 20 Gene [Source:MGI Symbol;Acc:MGI:1917311]

 
Come back to gene ENSMUSG00000040127


For any suggestions or comments, please send an email to unitrap@crg.es