Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CE0352
Clone ID CE0352
Vector pGT0lxfT2v
Project sanger

Sequence tag CE0352
Sequence
TTTTTTTTGAAGCTCAAGATGACCTTAAACTTCTGCTTCTAACCCTTTACCTGCGTATCCCATGTGCTGGAACTACAGGG
CATTGTTGTGACTCCGGTGCTCCTGCTGCTTTTC
Sequence Type mRNA
Unitrap ID UNI1779

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 81113071..81186921 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031684 (Slc10a7) NM_029736 solute carrier family 10 (sodium/bile acid cotransporter family), member 7 Gene [Source:MGI Symbol;Acc:MGI:1924025]

 
Come back to gene ENSMUSG00000031684


For any suggestions or comments, please send an email to unitrap@crg.es