Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14898E12
Clone ID IST14898E12
Vector VICTR76
Project tigm

Sequence tag IST14898E12HMF2
Sequence
CAATGTCTTGGTAATCCAAGAGTTCCTATAGGGAGATGGAAGATGGAGACAGAAGAATCCCTGCAAGCTCATAGACCAGC
TAGCCTGGTGTCTACAGTGGTGAACGATGAAAAAGACCCGCTCTCAAACAGGATGAAAATCAAAAGCTAACAGTCTAGAT
TGCTGACTGATCTACACACACACACACACACACACACACACACACACACACACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 60694369..60694581 213
NO GENE  


Sequence tag IST14898E12HMR1
Sequence
NTGGGACTGANCTTCTTGCCTCTGCCTCCCAAGCACTTGGGTTGCAGATGTGCACCACCACACTTGGGTCACATTTGCTT
AAAGTCTTTCCTAGAACTCTTCTAGTGGTTTAAACTTTGAAAAGATTAATACAGTTTTTTACNTTAGTTTTGTGAGGGGA
GGGCAGGGNGGANCANGNGCAN
Sequence Type genomic DNA
Unitrap ID UNI16290

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48798298..48798477 168
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032267 (Usp28) NM_175482 ubiquitin specific peptidase 28 Gene [Source:MGI Symbol;Acc:MGI:2442293]


Sequence tag IST14898E12BBF1
Sequence
CCATGTCACCTTCAGCATCCTCAACCACAGGGTTCAAGGCCAGCCTGAGCTATCTGAGAGCTCATCTTAAACTAACAAAC
AAAACAAGAACAAAAAACGAAAGAGTAAGAGAGCGGAGGAGGAGAGGAGGAAGGTAGCTAAGCAGGGCTCTGTGCTGGGG
CACCTGTAGTAATACCTCTGGGAGGTAAGGTAGGAAGGTTCAAAAACTGCAGTAAGACCCTGTCTCAAAACAAACCAAAC
CCCACAAAACAACAGCCACAGGAGGGGACAGAGCTCAGAGGTGAGGGGCTTCCCTAGCCCGCTAGGGTTTGGTCCCCAGC
ACGACACAAATACACAAAATAAACATACTCACTTTGACTCAAGCATGGGGGCACACTCCTGGGCAGCACTTGGGANGCAG
GTACAAGCAGATCTCTGTGAGTTNNANNCTTTTCTGGCTTACATAGTAAGTTCCNNNCAGTCNNGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 48797847..48798300 444
NO GENE  

 
Come back to gene ENSMUSG00000032267


For any suggestions or comments, please send an email to unitrap@crg.es