Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14960G2
Clone ID IST14960G2
Vector VICTR76
Project tigm

Sequence tag IST14960G2HMR1
Sequence
AGAGTGGGGACAAAGAGAATGACTTATTTGGTAAGTTAGCAAAACCNGAAGAAGGT
Sequence Type genomic DNA
Unitrap ID UNI32352

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65058682..65058737 54
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054733 (Msra) NM_026322 methionine sulfoxide reductase A Gene [Source:MGI Symbol;Acc:MGI:106916]


Sequence tag IST14960G2HMF1
Sequence
CTCTTTCTAAAATATTCAGGTCCCTTTCCAAGTGGAAAGCACATGAACTTGGATTCTGTACTGGGAACAGTGAGAACCTT
TCAGGAACGAATACTCCCAAGAGTGGGGGGTTAGAAACATTACAATAGGGCTGACAAGGTAAAAGGTCAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 65058734..65058884 151
 
EST/CDNA Est Name
  AA245926.1

 
Come back to gene AA245926.1


For any suggestions or comments, please send an email to unitrap@crg.es