Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14407C5
Clone ID IST14407C5
Vector VICTR74
Project tigm

Sequence tag IST14407C5HMF1
Sequence
CACCTACACACACCCACACAAATCCAAGTTTCTCTGTGTAACAACCCTGACTCTCCTGGAATTTCTTTTGTAAACCAGGC
TGGCCTTGAACTCACAGAGATCTACCTGCCTCTGCCTCCTCAGTGCTGGGGTTAAAGGTGTGCAACACTATGCTTGGCCC
CCATTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI5825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65564430..65564602 173
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040524 (Zfp609) NM_172536 zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]


Sequence tag IST14407C5BBF1
Sequence
CACCTACACACACCCACACAAATCCAAGTTTCTCTGTGTAACAACCCTGACTCTCCTGGAATTTCTTTTGTAAACCAGGC
TGGCCTTGAACTCACAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI5825

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65564500..65564602 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040524 (Zfp609) NM_172536 zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]


Sequence tag IST14407C5HMR1
Sequence
TGAATTTCTTGGCTTGAAANAAAGCTCTCANCCTGTATCATGTTCTCANANANATACNTGGGGATANAACTCCTGCCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000040524


For any suggestions or comments, please send an email to unitrap@crg.es