Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14305A4
Clone ID IST14305A4
Vector VICTR74
Project tigm

Sequence tag IST14305A4HMR1
Sequence
TTCTGACACTCGCACAGACATACGTGTAGGCAAAACACCAGTGCACAAAAATTAAAGGTAAATCTTTTAAGAAAGAAATT
TCAAATTTTATATACATATATAGGTTTGATTTGAATACACTATGAAATCCATTATGGCTTACATTTTGTGGACTCTTGAG
TTGGAATAAAGACTAGAAAGGCTAATTATTTTGTTC
Sequence Type genomic DNA
Unitrap ID UNI5320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88141118..88141311 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001415 (Smg5) NM_178246 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2447364]


Sequence tag IST14305A4HMF1
Sequence
AGATCCCATAGTTACAGTTAATGAGCTGCTATATGGGTGCTGGGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88141077..88141120 44
NO GENE  

 
Come back to gene ENSMUSG00000001415


For any suggestions or comments, please send an email to unitrap@crg.es