Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13201H8
Clone ID IST13201H8
Vector VICTR74
Project tigm

Sequence tag IST13201H8HMR1
Sequence
GTGGTGGTGCCCGCCGCCCCCGTGCAGGCTCCCTGTCCCTGAGGACTTACCTCGGGAGGTACGATCTCCTGTAAGCACCC
GGCACTGCCTCCTGGACACACCCTGCTTTGACTTANCGCCNAAGCTTCTGTCTCTGTGTTTGGTCTTCCTTTTGGGCCTT
GACAGAACAGGTGAAAATCTGGCCCCAAGGTTGATGCCCCAGGTGCATTTTAAATAGAAGTCACTTCTGCTCCAGGCTCT
GGTGAACTCTTAGGTAAAGAGCTGCAGGATCGCAGTGCACACTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI2948

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 127539723..127540010 284
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074238 (BC002199) NM_145964 BC002199 protein [Source:UniProtKB/TrEMBL;Acc:Q99LV9]

 
Come back to gene ENSMUSG00000074238


For any suggestions or comments, please send an email to unitrap@crg.es