Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14224B5
Clone ID IST14224B5
Vector VICTR74
Project tigm

Sequence tag IST14224B5HMF1
Sequence
GGTCTACGTACTAAACTCTATTTCAAAGCAAAACAATAACATAAAGACTCAACCACTATCGTAGGCCAAGCAGAAGAGGT
TGTTTTAAGGAGGTTGGCTGAGGAAACTGGATTCGTTTCAATGTTTTCTTGTGCAGGGGACTTCCTCATCATAGGATGTT
C
Sequence Type genomic DNA
Unitrap ID UNI30506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154998297..154998456 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042202 (A530082C11Rik) NM_177186 RIKEN cDNA A530082C11 gene Gene [Source:MGI Symbol;Acc:MGI:2444240]

 
Come back to gene ENSMUSG00000042202


For any suggestions or comments, please send an email to unitrap@crg.es