Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14968A7
Clone ID IST14968A7
Vector VICTR76
Project tigm

Sequence tag IST14968A7HMF1
Sequence
CTCCAAACTGCAACCAGCAGAGGCAGGACTCTGAGCCACATGCTGGAGGAAAGCTGATGCTGGCTTACAGGGTACAGGCT
CTTTCTGGAGAAGGAGGACCCAGAGTGGAGCCTTGAAAGCTGGGTAAAGCCGAGCAAGGCCTGGGGGCAGGGCACAGGAG
CAGGAAATTAGATGGCATCTTTCAGAAAGCTCTACAAACCTCTGTGCCCATTCAGGCTCCAGCCCTGTGGTCCTGGCTCG
GCCCAATTANCCAGCCTGGCTCCTGCAGGGGCCAATTAAACAGGGGCCGGGGTCANATGCAGGCCAAGGCCCTGTAGCCC
CTCANANCTTCAGGAAGGTAANCACAAAAGCTTTCTCTGCTGCTTGGGAAGGAAAANAACANAAGACANAGANNNTGCNN
NGTGCTTTTGTTN
Sequence Type genomic DNA
Unitrap ID UNI32812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57888870..57889281 384
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037716 (Ccdc33) NM_029212 coiled-coil domain containing 33 Gene [Source:MGI (curated);Acc:Ccdc33-001]


Sequence tag IST14968A7HMR1
Sequence
GGAGCTGACCTGACTGACCCTTGCCTTCAGGCCAGGGAGTCCAGGGCTGCTGTTCAGGGGGCTGTANAGGGGACAGAGCT
CTCCCCAAAGTGATTCTGATAACCCTATCACAAGGATCCTTCCCGTTGGTCACCTCCTTATTCCCCTGCTTTCAGAGAGA
GGCTGCCTGTGATTGTACCCATGGGCCTTCTCTGATGCTGTCCGCTGACTGCCANAANCCCCGTCCTCTGTTTTCTTCCC
CTCATCTGCCTTCTTCCTTCTCTGGGTTCTGAGTGTGGGCTCTAGTGGCCTGGGTTANAACCGGGACCCCCATCAAAGGT
TCCTGANACCAGGATCAACTANGANTGGTGTCCTGGCCCTCCCCCACCTTACCTCCTACTCAGGCTGGCTCTGGGAATGC
CTCTGCTGGTTGCCTGGCAACACACCCTTACNCACCTGCAGCTTGANNGANCTGACCCATCATGANAATCNATGGGTATG
GNGGCNCACTTACNNANCGNCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 57889278..57889781 464
 
EST/CDNA Est Name
  AV274471.2 - CB274069.1

 
Come back to gene AV274471.2 - CB274069.1


For any suggestions or comments, please send an email to unitrap@crg.es