Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13066B2
Clone ID IST13066B2
Vector VICTR76
Project tigm

Sequence tag IST13066B2HMF2
Sequence
GCATAGCCTGTTGGAGGATGACTGTATAATGTAGTGGTGAACGGAGACATGATACTGTGTTTTGTAACCTTGGGCAGGAG
GAGGAAAATTAGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI26806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 40548266..40548362 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020328 (Nudcd2) NM_026023 NudC domain containing 2 Gene [Source:MGI (curated);Acc:Nudcd2-001]


Sequence tag IST13066B2BBF1
Sequence
CTCAACACCTCAAAACCTNANAGTTGGANGANAGGCACATNNNCNACAAGGCCNCACCTCTCAATGGCACAACTCCCTGT
AAATCTATAGCTGCCAAGGATGGGCCTTGGCTTGGAGCGGTTCTATGGAAGGGTTGTCTGGGTGAGTGGAAAACAAAGGA
CTCTTTGGATAGCTAATCTTCTGCAGATTATAAACCCTATCTTTTATTTTATATATCAATCCAATCAGTTACTCCAGGTT
CCCTTTTGATTATCCTATGGATCTGCATCTCTTGACCGCAGCCCCTTAACTCTTAGGAGACAGCCNGCACGTATTTCCTT
TTAACCTTGCAAAAGAATTCNGANATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40469219..40469567 325
 
EST/CDNA Est Name
  AI593256.1

 
Come back to gene AI593256.1


For any suggestions or comments, please send an email to unitrap@crg.es