Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A041C03
Clone ID A041C03
Vector pT1betageo
Project ggtc

Sequence tag A041C03
Sequence
TTGCGGACTGTGCAGTGGGTCGGCGGCCAGACAGCTATANNNCGTGGTGGAAGTAGCCAGTGAGTACCCTGCACCATGGC
ACTGCCGTTCCGGAAGGACTTGGGGGACTACAAGGACCTGGATGAGGACGAGCTCCTTGGCAAGCTGTCCGAATCAGAGC
TGAAACAGCTGGAGACTGTCCTGGATGATCTTGACCCCGAGAATGCCCTTCTGCCTGCAGGGTTTCGGCAGAAGAACCAG
ACATCAAAGTCTGCCACGGGACCCTTTGATAGAGAACGGCTCCTTTCTTACCTAGAGAAGCAAGCATTGGAGCACAAAGA
CCGGGACGATTATGTGCCCTACACGGAGAGAAGAAAG
Sequence Type mRNA
Unitrap ID UNI12061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 75377176..75407340 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058587 (Tmod3) NM_016963 tropomodulin 3 Gene [Source:MGI Symbol;Acc:MGI:1355315]

 
Come back to gene ENSMUSG00000058587


For any suggestions or comments, please send an email to unitrap@crg.es