Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A041B04
Clone ID A041B04
Vector pT1betageo
Project ggtc

Sequence tag A041B04
Sequence
CCCTCAGCCGGCCGCGGCAAGTAGCGAAGCCGGAGAAGTCGCGGCCGCTCCGCCGCCGGCGCGCGTCCTTCCCCCTCCGC
CACCTTTTCTCTGATTCAAGCCCGCCGCCCCAGGCTTCGCTCAGCCGAGCCCGCAGCCCACGCCGCGGCCGACATAGCTT
CTTGTT
Sequence Type mRNA
Unitrap ID UNI1511

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 89149980..89150146 163
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006262 (Mobkl1a) NM_026735 MOB1, Mps One Binder kinase activator-like 1A (yeast) Gene [Source:MGI (curated);Acc:Mobkl1a-001]

 
Come back to gene ENSMUSG00000006262


For any suggestions or comments, please send an email to unitrap@crg.es