Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M073F03
Clone ID M073F03
Vector ROSAbetageo
Project ggtc

Sequence tag M073F03
Sequence
TATTAGAGCCTCTGCCTGGCTGTCAGTGACTCAGTGTTCGCGGGAACGCTGCCTCAGCCTCAACACCAGCCAACCCAAAT
CCCGAGGTGCGCCAGCGCCCAGCCCAGATCTCCACGCCTGCCAGGAGCGAGCTTCGCCGGCTCGCTGTCCCCCTGAGCAG
CCTCTGTCCTTCTGTCCAAGTCCCGCGCCCTTCTCGGGACCCCTGCCCAGCGGGCAGCACTGTCACCCTGCCGGCCATGG
AGACCCCGTCACAGCGGCGCGCCACCCGCAGTGGGGCGCAGGCCAGCTCTACCCCACTGTCGCCCACTCGGATCACCCGG
CTGCAGGAGAAGGAGGACCTGCAGGAGCTCAATGACCGCCTGGCCGTGTACATCGATCGCGTGCGTTCCCTGGAGACCGA
GAACGCGGGGCTGCGCCTTCGCATCACTGAGTCTGAAGAGGTGGTCAGCCGAGAGGTGTCCGGCATCAAGGCGGCCTACG
AGGCCGAGCTGGGGGATGCCCGCAAGACCCTTGATTCTGTGGCCAAGGAGCGCGCCCGCCTCCAGCTAGAGCTGAGCAAA
GTGCGTGAGGAGTTCAAGGAGCTGAAGGCTCG
Sequence Type mRNA
Unitrap ID UNI10494

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88306670..88307261 590
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028063 (Lmna) NM_019390 lamin A Gene [Source:MGI (curated);Acc:Lmna-001]

 
Come back to gene ENSMUSG00000028063


For any suggestions or comments, please send an email to unitrap@crg.es