Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W242B04
Clone ID W242B04
Vector ROSAbetageo
Project ggtc

Sequence tag W242B04
Sequence
GTGTCGGTTGCTGGAGCAGAACAAGCTAGCGATGCTACGGCAGCCGCTTCCTGATTGGCTGCGTGTGGCTCCCTCTTCGT
TCTGATTGGCCGCGAGTGATCTGT
Sequence Type mRNA
Unitrap ID UNI12064

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 28271994..28272097 104
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000008384 (Sertad1) NM_018820 SERTA domain containing 1 Gene [Source:MGI (curated);Acc:Sertad1-001]

 
Come back to gene ENSMUSG00000008384


For any suggestions or comments, please send an email to unitrap@crg.es