Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W215F02
Clone ID W215F02
Vector ROSAbetageo
Project ggtc

Sequence tag W215F02
Sequence
CTCGTCTGCGGGAAGCCGTGTCTCCGCAGTGACGTGGGCGGGCCGCGGGCCGGGTGACGTCAGAGGCTGTGTGTAGCGAT
GTGTGTGGGGTTCGGAGCGGCGCCGGCACAGCGAAGGCGGCTGGCGAGCGACGGCGACGGCGACGGCGACGGCGGGCACA
G
Sequence Type mRNA
Unitrap ID UNI12068

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 30993927..30994072 146
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027660 (Skil) NM_011386 SKI-like Gene [Source:MGI (curated);Acc:Skil-001]

 
Come back to gene ENSMUSG00000027660


For any suggestions or comments, please send an email to unitrap@crg.es