Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W212C04
Clone ID W212C04
Vector ROSAbetageo
Project ggtc

Sequence tag W212C04
Sequence
AAGATCCACCAGCTACACTGAAACCAAAGATCCCTCTTGTGGTCAGGAGGCTGCAGCTCCATCTGGGCCACAGCTGCAGG
TCCTTGAACCAAAGGAGAAGGCTCCCACGTTCTCAGCGTCTGTCCGGGGGAGGCATTTGAGCCATCCTGAGCCAGAGCAT
CAGCACGTGTATCCACAGGTTGCAGCCGGAGCAGGGGAGCCCAACAGAAGTGTTAAGATGAAGAGTCAGACCCACCAGCT
TCCACTCAGCCTCAAACCTCAGAGACTCAGATCTCTCATCTGCCAGAATCAGAAAGGACTCATCACACTGT
Sequence Type mRNA
Unitrap ID UNI12069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55281005..55282610 177
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022185 (Acin1) NM_023190 apoptotic chromatin condensation inducer 1 Gene [Source:MGI Symbol;Acc:MGI:1891824]

 
Come back to gene ENSMUSG00000022185


For any suggestions or comments, please send an email to unitrap@crg.es