Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14410F9
Clone ID IST14410F9
Vector VICTR74
Project tigm

Sequence tag IST14410F9HMR1
Sequence
CCTAAACNAGAAATATCTTTAGAGACCCAGCCTCTTGGGCTGCCTTC
Sequence Type genomic DNA
Unitrap ID UNI15587 UNI16988 UNI30509 UNI31035 UNI31842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6002259..6002304 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24050004..24050049 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 6649129..6649174 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 28107535..28107580 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 8765241..8765286 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 112769503..112769548 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55704366..55704411 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25519162..25519207 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 14232599..14232644 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9893429..9893474 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38948233..38948278 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048720 (Tbc1d12) NM_145952 TBC1D12: TBC1 domain family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2384803]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20420792..20420837 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52921577..52921622 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048332 (Lhfp) NM_175386 lipoma HMGIC fusion partner Gene [Source:MGI Symbol;Acc:MGI:1920048]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40554232..40554277 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3255880..3255925 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3112847..3112892 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 14347007..14347052 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070811 (C730007P19Rik) RIKEN cDNA C730007P19 gene Gene [Source:MGI Symbol;Acc:MGI:3690091]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5222981..5223026 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7803866..7803911 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 823229..823274 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166342: 220182..220227 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 32841..32886 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15920700..15920745 44
NO GENE  


Sequence tag IST14410F9HMF2
Sequence
GGTAATAATTAATGTGGTTCGTATCCTAAATAGTAAAATTTAAAATAAGATTTAAAGCAATGTCTCTTTATTAAAGCATT
AAAGCTTGCTTTAATAGGTATTCATAGGTATTAATTGACATCCAAACTTCGTAATATGATAGTAATGCTTCTAATATTGA
TTTTAAAGATAATAAATTGTTTTAAACTTGGGTTTTGCTTTCCCAAGGTTACAGGTATTATCCTAACCTTGCACAAAAAC
TTAAAAATTATGGTTAAAACTGCTATTGTTCCATTGACTGCAGCTTGCAGTTTGACTTCAAATTTAAGATCTTTAATTCA
CCTGTATACTGTAATTAAGATAATTACAAGAGTAATCATCTTATGAGAGCGCTCATACAGCTCACTTCATACNAAACTGT
GACAGANTTATCTAGTTATGTNNGTCNTTGTAAATNGANTANNCAAACAGTTTGGTTANAGTTGCTGCCTGGCNNGANAC
TGNNNTNNNGGNNATTTTTTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14410F9BBF1
Sequence
GGTAATAATTAATGTGGTTCGTATCCTAAATAGTAAAATTTAAAATAAGATTTAAAGCAATGTCTCTTTATTAAAGCATT
AAAGCTTGCTTTAATAGGTATTCATAGGTATTAATTGACATCCAAACTTCGTAATATGATAGTAATGCTTCTAATATTGA
TTTTAAAGATAATAAATTGTTTTAAACTTGGGTTTTGCTTTCCCAAGGTTACAGGTATTATCCTAACCTTGCACAAAAAC
TTAAAAATTATGGTTAAAACTGCTATTGTTCCATTGACTGCAGCTTGCAGTTTGACTTCAAATTTAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 19095..26631 248
NO GENE  

 
Come back to gene ENSMUSG00000070811


For any suggestions or comments, please send an email to unitrap@crg.es