Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14793A5
Clone ID IST14793A5
Vector VICTR76
Project tigm

Sequence tag IST14793A5HMR1
Sequence
CTATTTACGTATTTAGAAACAGGGATTCACATGCATGTAGCCTAAGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138038641..138038688 48
NO GENE  


Sequence tag IST14793A5HMF1
Sequence
TTAGTACACGAATCAACCCCAACAACGTAGTTTCATCTCTCCCGTCCTTCCCGATCCCTGAGAGACTGTGGCCCCCAGTG
CTCATCTCCCTCCTTTTGCAGATGCCCCCCAGCAGCTGGA
Sequence Type genomic DNA
Unitrap ID UNI13008

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138038526..138038643 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]


Sequence tag IST14793A5BBF1
Sequence
TTANTACACGAATCAACCCCAACAACGTAGTTTCATCTCTCCCGTCCTTCCCGATCCCTGAGAGACTGTGGCCCCCAGTG
CTCATCTCCCTCCTTTTGCAGATGCCCCCCAGCAGCTGGCCACCAGCTCCTTCCTGCTCTTCTTGCTGGCAGGCGTCATC
TCTGTGGCCTTCCTGCTCCTACCACTGCAGGATGAGCTTGGCAGCCAGCTGCCTCAAGTCCTGCACGTGTCCCTGGGACA
GAAGCTGGTTGCGGCCTACGTCTTAGGTGAGCACAGTGGAGGAGTACNGGGCCNTCTTCCGGANAAAGGATAGGGAGAGG
AAGGCCCCTACATGNACNCTCN
Sequence Type genomic DNA
Unitrap ID UNI30137

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138038304..138038643 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037221 (Mospd3) NM_030037 motile sperm domain containing 3 Gene [Source:MGI (curated);Acc:Mospd3-001]

 
Come back to gene ENSMUSG00000037221


For any suggestions or comments, please send an email to unitrap@crg.es