Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11117A5
Clone ID IST11117A5
Vector VICTR76
Project tigm

Sequence tag IST11117A5BBF1
Sequence
GAGGCAGAGAGGCAGAGGCAGAGAGGCAGAGAGGCAGAGGC
Sequence Type genomic DNA
Unitrap ID UNI32819 UNI32820 UNI32821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 21259514..21259554 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 77595100..77595140 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 71996232..71996272 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4802488..4802528 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 36298157..36298197 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021420 (Fars2) NM_001039189 phenylalanine-tRNA synthetase 2 (mitochondrial) Gene [Source:MGI Symbol;Acc:MGI:1917205]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55785913..55785953 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 102972883..102972923 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 17289968..17290008 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 64961203..64961243 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024085 (Man2a1) NM_008549 mannosidase 2, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:104669]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 48977163..48977203 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 44987969..44988009 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 53115387..53115427 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 132684533..132684573 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 137777114..137777154 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 64953001..64953041 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17387906..17387946 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 49327257..49327297 41
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 32323308..32323348 41
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000016087 (Fli1) NM_008026 Friend leukemia integration 1 Gene [Source:MGI Symbol;Acc:MGI:95554]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34319497..34319537 41
NO GENE  

 
Come back to gene ENSMUSG00000016087


For any suggestions or comments, please send an email to unitrap@crg.es