Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14999E7
Clone ID IST14999E7
Vector VICTR78
Project tigm

Sequence tag IST14999E7HMR1
Sequence
AAANNNCTNNTCCCCTTTCTGTATATCCCAACCNCCGGCATGACGAAGAACCGCCAAGAAATGCTGGTGCCTGCTGCCTT
TTGCANAGTAGGGAAAACTTTAGTATGGAGACCTCAGTGTGTTCCTCC
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6044900..6045017 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST14999E7HMF1
Sequence
TTACTACTAATTTAGCTCAATACTGGCAACACGTAAAAAACATAAAAACCATCCACCCTAAGAAAATTCAGTGGCTTTGA
GACATCTTCATAGAGGGATTGCTGTCTTTTCTTTTTAACCCACTCAGAATGTATTGACCATCCCTTTGCGCTTTTCAATT
CTCTTCTGTGTGCCACGTTTCTGTTGAGAAGGAAATAACAAGTGAAACCGCTTGTCTTGTTTTTTGCANACTGCATCTAA
TGCAAAAGCATTCCNGCAGTCCAGGAGAATGTGATTTTCCCAGGAGCCGACAAGTGCNNTGCNNNCATCCGATGCACAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6045026..6045343 304
NO GENE  


Sequence tag IST14999E7BBF1
Sequence
TTACTACTAATTTAGCTCAATACTGGCAACACGTAAAAAACATAAAAACCATCCACCCTAAGAAAATTCAGTGGCTTTGA
GACATCTTCATAGAGGGATTGCTGTCTTTTCTTTTTAACCCACTCAGAATGTATTGACCATCCCTTTGCGCTTTTCAATT
CTCTTCTGTGTGCCACGTTTCTGTTGAGAAGGAAATAACAAGTGAAACCGCTTGTCTTGTTTTTTGCAGACTGCATCTAA
TGCAAAAGCATTCCAGCAGTCCAGGAGAATGTGATTTTCCCAGGAGCCGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6045026..6045316 291
NO GENE  

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es