Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W251A07
Clone ID W251A07
Vector ROSAbetageo
Project ggtc

Sequence tag W251A07
Sequence
GCGAGAAGGAGACGGACGTTGAGAGAACGAGGAGGAAGGCGAGAAAATGGCGTCCACGG
Sequence Type mRNA
Unitrap ID UNI7060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4999012..4999070 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009079 (Ewsr1) NM_007968 Ewing sarcoma breakpoint region 1 Gene [Source:MGI (curated);Acc:Ewsr1-002]

 
Come back to gene ENSMUSG00000009079


For any suggestions or comments, please send an email to unitrap@crg.es