Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11670G1
Clone ID IST11670G1
Vector VICTR76
Project tigm

Sequence tag IST11670G1BBF1
Sequence
CCTTCCTCTGNNNGCNAAGAAGTTGAGTGTGCCAATAATGAAATAACTGAAAAGCTACTACTACCCAAAACTACGTGGTC
CTCGGCAGTGCTCAGCAAGCCCTTTCTANTCCCTGTAAAANATTTGCTTACAGTTGGGTAAGGCCCACCTCTGNNTTTGT
AGGTGGATGGTTAAGGGTTTATTTTTAAAGATTTATTTATTTCATTTATGANTACACTGTAGCTGTCTTCANACACACCA
GAAGAGGGCATCANACCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCATGACCTCTGGAAG
AGCAGTCAGTGCCCTTAACTGCTGAGCGATGCATCTCTCCAGCCTGATGGTTAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97856986..97857364 357
 
EST/CDNA Est Name
  CX733968.1


Sequence tag IST11670G1HMR1
Sequence
AGGTGAGTGTTTGGGTACGTCTAGGGCATCTAGGACTTAGGGCCTGTGGAGGACATGGGGAGAANAAAAAGTTAAGGCAA
AGATGGGTTGAGGTGGCGTANAGCAGAGCTTGTGTTGGTTAGGGAACGAAATCAGGGAGACAAGGGAGGAAACACTCATG
GCTANAAACTGGCGTTGTGTGTGAGGTTGANAGAGCATTACTGANCGCTGCCTANAANCCN
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97857362..97857581 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es