Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11925F6
Clone ID IST11925F6
Vector VICTR76
Project tigm

Sequence tag IST11925F6HMF2
Sequence
CTGGGAATTGAACTCANGACCTCTGGAAGAACAGCCNNTG
Sequence Type genomic DNA
Unitrap ID UNI3733 UNI3975 UNI11188 UNI22868 UNI32823 UNI32824

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 29803620..29803655 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 24177213..24177248 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30793294..30793329 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033826 (Dnahc8) NM_013811 dynein, axonemal, heavy chain 8 Gene [Source:MGI Symbol;Acc:MGI:107714]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 15591912..15591947 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 41304495..41304530 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022307 (Oxr1) NM_130885 oxidation resistance 1 Gene [Source:MGI Symbol;Acc:MGI:2179326]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 18890779..18890814 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041236 (Vps41) NM_172120 vacuolar protein sorting 41 (yeast) Gene [Source:MGI Symbol;Acc:MGI:1929215]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 29602438..29602473 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 50136812..50136847 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67513647..67513682 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 27907053..27907088 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040717 (Il17rd) NM_134437 interleukin 17 receptor D Gene [Source:MGI Symbol;Acc:MGI:2159727]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 10008005..10008040 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 67444637..67444672 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 28157481..28157516 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 25656506..25656541 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011349 (Dmrtc2) NM_027732 doublesex and mab-3 related transcription factor like family C2 Gene [Source:MGI (curated);Acc:Dmrtc2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20653028..20653063 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 122765391..122765426 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 41404997..41405032 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025764 (Phf17) NM_172303 PHD finger protein 17 Gene [Source:MGI Symbol;Acc:MGI:1925835]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 41560192..41560227 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 91149413..91149448 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 75575306..75575341 34
NO GENE  


Sequence tag IST11925F6BBF1
Sequence
CCATGTGGTTGCTGGGAATTGAACTCANGACCTCTGGAAGAACAGCCAGTGCTCTTAACCTCTGAGCCATCTCTATAGCC
CCAGCATTTTGTTTCATTGTTTTGTTTTTGTTANGACAGGATTTCTCTGTGAAGCTCTGGCTATTCTAGAACTCACTCTG
TANACCANGCTGGCCTCANAACTCANANATCCCCCTGCCTCTCCNGTGCTGGGACTAAAGGCGTGCGCCACANCCNNNCN
GGTGTTCCTGTTTTTTATTTTCTTTGANACTGANTTTCATGTANCTCANGCTGGCCTCAAGTTCTTTGTANGCAATGCTG
ACCTTGATCGGATGCTCGTACCTCTATTTCCANNGTGCTGCNCCANCTTGCTTCTTTTGTGCTGTGCTANGATGGAACCC
ANGGCTTTCTGCATGCTGGCTTANCACTCCACCNACTTGAGCCGCACCCTCAACCCNNNNATTNNNATGCACTCCCNTTT
NNTTNCTCGCATACNCNTTACTCTGAANCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000025764


For any suggestions or comments, please send an email to unitrap@crg.es