Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11618C5
Clone ID IST11618C5
Vector VICTR76
Project tigm

Sequence tag IST11618C5HMR1
Sequence
TGATGCATGCTCTTTTTCTATTCTCAATATTGAAGAACTTTTTAATGGATGATGCAAGAGTACTTTCTCCCATCGGATGG
ACAAACTTGCTCATAGCATCC
Sequence Type genomic DNA
Unitrap ID UNI24722

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 105044331..105044430 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020694 (Tlk2) NP_036033 tousled-like kinase 2 (Arabidopsis) Gene [Source:MGI (curated);Acc:Tlk2-001]

 
Come back to gene ENSMUSG00000020694


For any suggestions or comments, please send an email to unitrap@crg.es