Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11254G6
Clone ID IST11254G6
Vector VICTR76
Project tigm

Sequence tag IST11254G6HMF1
Sequence
CACCTTTAATCCTAGCACTTGGGAGGCAGAGACAGG
Sequence Type genomic DNA
Unitrap ID UNI20157 UNI32827 UNI32828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 3731362..3731397 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 52993181..52993216 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 90640514..90640549 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 74312112..74312147 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 8014757..8014792 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 20437999..20438034 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 12907460..12907495 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019814 (Ltv1) NM_181470 LTV1 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2447810]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 128278411..128278446 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 26504839..26504874 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 125730466..125730501 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108808328..108808363 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028559 (Osbpl9) NM_133885 oxysterol binding protein-like 9 Gene [Source:MGI (curated);Acc:Osbpl9-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 55161865..55161900 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 149585628..149585663 36
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041658 (Rragb) NM_001004154 Ras-related GTP binding B Gene [Source:MGI (curated);Acc:Rragb-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 181735882..181735917 36
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 55067992..55068027 36
NO GENE  

 
Come back to gene ENSMUSG00000041658


For any suggestions or comments, please send an email to unitrap@crg.es