Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11261B5
Clone ID IST11261B5
Vector VICTR76
Project tigm

Sequence tag IST11261B5HMF1
Sequence
CTCTGCTCTTGGATGTTCTTGGCTGATTTGGTTCAGCCTCTCTTCCCTACACCTGTCTCCTGCCTCTGAATTGCCCATCC
AAAGTGAAGCTACAGGGGTGGGGATCAAGAGGAAGGGAGAAGGGCANANAGACATTCTAGGGGCTCTGGGCAGTGGANAG
GGTGGTCCTTAAACCTGACTGCTGTANCCATGGA
Sequence Type genomic DNA
Unitrap ID UNI20147

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148240483..148240675 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]


Sequence tag IST11261B5HMR1
Sequence
CAGAGTGAGGGCAAAAAAACAAAACAAAACAAACAAAACAAAAAAAACCCAAAACGGTGTCCTGTCNNACAGCAGACACC
AAGCTAATGCCTGGACAAGAGGGAGACTGAGGGCAGAAGGGAGCTGTTCTCANAGGCGCCATGAAGTCAAAACCNNTNTA
ANNANNNGTGGTGGNTACNNNNTNACTTTACAGTGGGCTTCCAGAAGGAACAGCAAAAGCAGCCCGTCACTCCCCCANCC
CTGTCCCTTTCATTTCACAAAGTCACTTAAGGACCCAAGGCAAAACTNNNNNNCCTGCTAATCTGGACAAGATCTTGACC
CTTGGATTCTTTTTTGTAACAGACTCCCCANNNGCCANGCNNGTCNNNNACTCACTACNCNNATGATGATTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es