Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W248A04
Clone ID W248A04
Vector ROSAbetageo
Project ggtc

Sequence tag W248A04
Sequence
TCCATCAAGTCTTGTTGGGTGCGGCCCGCCTTCATGTAGCGTTTGTNNNGAAGTAAAGGACTTATGGCATTAGAATTACC
TCAGAGGTGGGGGAAGGACTCTGAATTTGAAGGTGGAAAAGCAACTGTGAATTGTAGCACCATCCCGATTGCTGAGAGAT
TTTTCACCAGCTCTACCTCTCTGACTCTGAAGCATGCTGCATGGTATCCAAGTGAGATGCTGGATCCCCACATAAGTGCT
GTTGACATCAGACAACGTGAATAAGCT
Sequence Type mRNA
Unitrap ID UNI11593

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 70779209..70781485 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040667 (Nup88) NM_001083331 nucleoporin 88 Gene [Source:MGI (curated);Acc:Nup88-001]

 
Come back to gene ENSMUSG00000040667


For any suggestions or comments, please send an email to unitrap@crg.es