Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14042A12
Clone ID IST14042A12
Vector VICTR74
Project tigm

Sequence tag IST14042A12BBF1
Sequence
AAACTACGTGGAGCTCAGGGCAGTCTTCNACCAGTCCTCCTTCCTGCACAACGAGATGGANTGGCAGCGCCGGCTTCGCA
GTGAGGACCAGCGGGCGCCTCCTCCCCTTCCTGGGCTCCCCTGGGCAGAGGGTTCGTCAGGGACCCCTCATGCCACTCTG
TGTCCCCACCCAGGCATGCCGCTCATCTACTGGTTCTCCCGCCGCATGACGCTGTGGGGCANCATCTCCTTCAACCTGGC
TGTGTTCATCAATATCATCATTGCCTTCTTCTACCCCTATGTGGAGGGCGCTTCCACAGGTGAGGCTGCCCTCCTGCCCT
TGCCTGGTGGGGAGACACACCCCTATGCCGCCCTGTGGGCTTGATGCATGCTGTAGGGGTCAAGGGACAGACACACTCTG
GCCTCATGGANACAGCCTGAGTGAGTGTGTGTGTGCNCGCACACATGCAGATGTGATCCAGACACTTGANATGTCTGCAG
CANCTGGTANGGTGCANCANANGCNTCANANCCCTNANGANGGNTN
Sequence Type genomic DNA
Unitrap ID UNI32831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 27252967..27253466 466
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042644 (Itpr3) NM_080553 inositol 1,4,5-triphosphate receptor 3 Gene [Source:MGI (curated);Acc:Itpr3-001]

 
Come back to gene ENSMUSG00000042644


For any suggestions or comments, please send an email to unitrap@crg.es