Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W202C01
Clone ID W202C01
Vector ROSAbetageo
Project ggtc

Sequence tag W202C01
Sequence
GGAAANNNNGGGGGNANCAGACCCATCCCAAGCANTTGTCTTCCGCCCAGCCTGCCTCCATTANNNNCGTGTCCCGAACC
CCTCTTCGGGAGTGGTGTCGGTTTCATAACTTGAGTACGAATGGCAAGAAAGTTGAGGTCTATTTGAGACTTCGGAGACA
CTCCTATTCTAAACAAGAATGTTATATTCCCAATACATCTCGGGAGGCCAGAATGAAGCAGGGTNNNAAGAAATCCAAGA
TAGTCTTCAGAGGAATCGGGCCTCCAAGCGGGTGCCAAAGGAAAAAGGAGGAGAGTGGTGTCCTGGAAATTCTAACTTCA
CCTAAGGAGTCCACATTTGCAGCCTGGGCAAGGATTGCCATGAGAGCAGCTCAGTCAATGTCTAAGAATCGATGTCCTCT
TCCGTCTAATGTGGAGGCCTTTCTGCCACAAGCCACTGGATCCAGATGGTGTGTTGTCCATGGCAGGCAGCTCCCTGCAG
ATAAGAAAGGTTGGGTTCGCCTGCAATTTCTTGCTGGACAGACCTGGGTTCCAGACACTCCCCAAAGGATGAATTTTCTC
TTCCTGTTACCGGCCTGTATTATCCCAGAACCAGGAGTGGAAGATAATTTGCTATGTCCTGAATGTGTTCACAG
Sequence Type mRNA
Unitrap ID UNI12091

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48314036..48317596 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072419 (Dppa2) NM_028615 developmental pluripotency associated 2 Gene [Source:MGI Symbol;Acc:MGI:2157523]

 
Come back to gene ENSMUSG00000072419


For any suggestions or comments, please send an email to unitrap@crg.es