Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14977E2
Clone ID IST14977E2
Vector VICTR76
Project tigm

Sequence tag IST14977E2HMR1
Sequence
GACCTTTGAAAGAGCAGCTAATGCCCCTAACTGCTGAGCCNTCTCTCCAGCCCTAANAAATAGTATTAAAAAATCAGTTA
AAGTATAATTTCTCATGTCAATTCCTGGTTAAGTTACATTAGTAGCTTCTTTCATAGCTTTGTGGAATAGGTTTATATTA
GAATGAAACAGAACAAATCAGTAAAGACTTAAAGTTANATATTGCTATANTATTTTTTAAAATTATAATTATATCTAGTA
CAGTCAGGACTATACAGANAANCCCTGTCTANAAAAGGAAAAAAATTATAATTTTACATTTACACATGAAAATATTTTAA
ATTCTTCTAGACTGAAAATTAACATACAGTATATAAAATATGTCTCAACACAANATTTTGTATACGTCTATNNTGACTGA
NAAAAGTTTATTTTAAAGTTTTGTCTTATGGTAGTATATAAATGGCATANTCN
Sequence Type genomic DNA
Unitrap ID UNI14999

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 68846442..68846893 428
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034317 (Trim59) NM_025863 tripartite motif-containing 59 Gene [Source:MGI (curated);Acc:Trim59-001]


Sequence tag IST14977E2HMF1
Sequence
GGTCCTGANTTNNATTCCCAGCAGCNNCACAGTGGCTCACAACCNCCTGAAATGGGATCTGTTGCCCTCTCCTANTGTGC
ATGTGAAGACTAATGTGAAAACAGTGTGTCTACCNATATACATAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000034317


For any suggestions or comments, please send an email to unitrap@crg.es