Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11263H4
Clone ID IST11263H4
Vector VICTR76
Project tigm

Sequence tag IST11263H4HMR1
Sequence
AGCTAACTTTCTTTCACCTAAAAATCCTTTTCCTCCTGCTAGGCTCAGTTAGGTACCGCCGTGCCTCAGAGGCATCCCTT
TTCCATGGGCTGTTAATTCTCTCCTGTGCTCCTGTGACCCTTTAGGCCTGAGTTGTGACTTCATCTGGCTAGGGCTCCCT
TGGTGGCTTANATGTTCATCTTCCCCAGTGGAACGTGACCCTTGTAACCTGGANAGAACTTGAGCCTCTAAGCTGANACC
TGCNTCACTGGATGCTTTTATTCATGTGCCCCAAAGCTGGCACAGTAGGGGTAAAGAGAGTCCTCAGGTCNNANGAAGGA
NNCTTGGAAGACANGGANATGANCTCTTTGTCC
Sequence Type genomic DNA
Unitrap ID UNI2631

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4544622..4544973 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020412 (Ascc2) NM_029291 activating signal cointegrator 1 complex subunit 2 Gene [Source:MGI (curated);Acc:Ascc2-001]


Sequence tag IST11263H4BBF1
Sequence
AGCTTGCTTGTCCTCCTCCCTCCCTCCTCTTTTGTTTGTTTGTTTGTTTCTCACACATTTTTTTACTATATAGCCTTGGT
TGACCTGGAACTTACTATGTAGACTAGGCTGGTCTCANATTTAATAGAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4544492..4544625 132
NO GENE  

 
Come back to gene ENSMUSG00000020412


For any suggestions or comments, please send an email to unitrap@crg.es