Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14021C11
Clone ID IST14021C11
Vector VICTR74
Project tigm

Sequence tag IST14021C11HMF1
Sequence
CTAGAGCCTGGAAATTCCAAGCCCAAGATGCTGGCAGATTTGGTATCTGGTGAGACACTGCCTTCCTGCTCTGCACTCAT
ATAGGGGGAGGGGCAAAGTTGGATCTCTGAGGTCTTTTTCCTTTTGATATGGGGATTATGTTTGTGTGGTGTATGTGTGT
GTGTTTTGCTGTGAAAAATACTCTAACAAAAGCAACTTAAAGAAGGAAAGGTTTAATTTGCCTCCCATTACCAGAGGGAT
GCAGTCC
Sequence Type genomic DNA
Unitrap ID UNI23038

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 45585286..45585531 246
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023935 (Spats1) NP_081925 spermatogenesis associated, serine-rich 1 Gene [Source:MGI Symbol;Acc:MGI:1918270]


Sequence tag IST14021C11BBF1
Sequence
CTAGAGCCTGGANANNCNNAGCCCAAGNTGCTGGCAGANNNGGNANCTGGNGANACACTGCCTTCCTGCTCTGCACTCAT
ATAGGGGGAGGGGCANANNNGGATCTCTGANGNNNTTTTCCTTTTGATATGGGGATTATGTTTGTGTGGTGTATGTGTGT
GTGTTTTGCTGTGAAAAATACTCTAACAAAAGCAACTTAAAGAAGGAAAGGTTTAATTTGCCTCCCATTACCAGAGGGAT
GCAGTCGACCATGGTAGCGAAGACATGGCAGCAGGCATGAAAGGAATTGTGGTANTAGGAGGTTGACTGCTCACATTGTA
TCTACAGTCNAAATATGAACAGGGAGAAGTACCAGGCTGTANAGCCACAAGGCCTGCTCCCAGTAACCCACTTCCTACCC
CAAAAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000023935


For any suggestions or comments, please send an email to unitrap@crg.es