Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10190H8
Clone ID IST10190H8
Vector VICTR76
Project tigm

Sequence tag IST10190H8HMF1
Sequence
NAAACTCTCTTTAAGGGCAGCTTACATTGGTTTCATGGTCCTATAGTTAAGGATACAGGATTTGCCTGAGGCTCTGACAT
CACATTTGATTTGTGGTGTGGAAAATTACCTCCATCTTCTTTNATAAATTGGCTCTTANAGCCTGTCAGGAAGGAAAGGA
GTTAAATGANCAGTTATGTGCATGTGCACACATCTGTGTGATTTTTTACTATGTAGTGGGCCTCTGTGCAAGTTCTATGA
GGGTGACAGACACGGCAAAACTAGCTAATTATAAGGAATCTTACCTCANTGCTGTGCCTCTCTGAATGANAAAGTGCCTC
ATTCATTCATAGATAGATAGATAGGTTGATTGATAGATAGATAGATTAGCTCAGTAATACTCTTACAGGATATCAGTGAG
AAATAATTTGAGAACCCCATCTGCTTCCTCCTGCAGCCTGANGGGCCTTCANGTNAATGGGCACTTTCTGGCTGTCCTCN
NGTNNGTGATGCCTGCCTGGTTCCACCCTNNACTACAGAGTTA
Sequence Type genomic DNA
Unitrap ID UNI30611

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 127984841..127985359 485
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001995 (AC073946.23-201) NM_001081337 Signal-induced proliferation-associated 1-like protein 2 (SIPA1-like protein 2) [Source:UniProtKB/Swiss-Prot;Acc:Q80TE4]


Sequence tag IST10190H8BBF1
Sequence
AAAACTCTCTTTAAGGGCAGCTTACATTGGTTTCATGGTCCTATAGTTAAGGATACAGGATTTGCCTGAGGCTCTGACAT
CACATTTGATTTGTGGTGTGGAAAATTACCTCCATCTTCTTTCATAAATTGGCTCTTANAGCCTGTCAGGAAGGAAAGGA
GTTAAATGANCAGTTATGTGCATGTGCACACATCTGTGTGATTTTTTACTATGTAGTGGGCCTCTGTGCAAGTTCTATGA
GGGTGACAGACACNGNANAACTAGCTAATNATAAGGAATCTTACCTNANTGCTGTGCCTCTCTGAATGAGAAAGTGCCTC
ATTCATTCATAGATAGATAGNTAGGTTGATTGATAGATANATAGATNAGCTNAGTAATACTCTTACAGGATATCAGTGAG
AAATAATTTGAGAACCCATCTGCTTCCTCCTGCAGCCTGANGGGCCTTCNNNTTAATGGGCACTTCTGGCTGTCCTCNNN
TNANTGATGCCTGNCTGNNTNCACCCTTNACTACAGNNTNGANTGNNGTCTTGTGTGNNNCTNNNGNGTTNGNNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001995


For any suggestions or comments, please send an email to unitrap@crg.es