Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone W247A01
Clone ID W247A01
Vector ROSAbetageo
Project ggtc

Sequence tag W247A01
Sequence
GGGGGGCGGATATGGACGAACTCAACATCGACAGCATCATCCAACGGCTGCTGGAAG
Sequence Type mRNA
Unitrap ID UNI134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 122608572..122608624 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004455 (Ppp1cc) NM_013636 protein phosphatase 1, catalytic subunit, gamma isoform Gene [Source:MGI (curated);Acc:Ppp1cc-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 126883644..126883696 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000080975 (AC164158.3)  

 
Come back to gene ENSMUSG00000080975


For any suggestions or comments, please send an email to unitrap@crg.es