Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14611A2
Clone ID IST14611A2
Vector VICTR74
Project tigm

Sequence tag IST14611A2BBF1
Sequence
GTACCTCCCTCTACTGATCTGCTAACAGGAATTAATGGTGATATGAGCATAACACACAGGGCTAAGANTNGNAAGCCCCT
TCCAATGGCTTGCTCATCTACAGACACCACCTACAAACTATGCGCTCACATNNTCTCTCAGATTCTAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94825924..94826076 143
NO GENE  


Sequence tag IST14611A2HMR1
Sequence
TTACCAAGTTTNAAAATTTTATANTANTGAAAAAATGGAAACCACCCACACAGTGTTCAGTGGGTGCTTGCTACAGTGCA
CTCAGGTCTGTTCAGGGGAGCACTGTCANCCTGTTGATACCATGCAAGTGCANTCTGTAAACTTTTCAAGTTCACCTTTA
CCTTTTGAGTGTTTGAGTCTGTCTGTGTTTGTGTTGTGTATTTGCCATGTGTGCCTGGTGCCTGTGGAAACCANAAGAGG
GTGTCANATGCN
Sequence Type genomic DNA
Unitrap ID UNI14917

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 94826074..94826323 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074897 (CT030190.9) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3USJ7]

 
Come back to gene ENSMUSG00000074897


For any suggestions or comments, please send an email to unitrap@crg.es