Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10750A7
Clone ID IST10750A7
Vector VICTR76
Project tigm

Sequence tag IST10750A7HMF2
Sequence
GAATCATTGAGAAAAATGCCTGTGGGTAAGTCTGTCTGTCTGACATTTTCTTTTATTCATATGAGTACACTGTAGCTGTC
TTCAGACACACACCANAAGAGGACATCGGATTCCATTAGAGATGACTGTGAACCACCATGTGGTTTCTGGGGATTGAACT
CAGGATCTCTGGGAGAGCAGTCTGTGCTCTTAATCACTGANCCATCTCTCCAGCCCTGTCTGGCATTTTCTTGAGTAAAG
ATTACTGTGAGAAGGTCTGCCCACTGTGGGCGGTGCCAACAACAAGCCAGGAGGCANTGCTCCCTTGTGGACTCTGCTTC
AGTTCCTGTCCTGACTTCCCTCAATGATGGAGTGTGACCTGANANTTNTNANCTAAATNNNCCCTTTCCNNNNCAGGTTG
ATTTTGGA

Sequence Type genomic DNA
Unitrap ID UNI22780

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 84647930..84648336 377
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027078 (Ube2l6) NM_019949 ubiquitin-conjugating enzyme E2L 6 Gene [Source:MGI (curated);Acc:Ube2l6-001]


Sequence tag IST10750A7HMR1
Sequence
TTTGTTTTTAAGGATAAAATCAGACTATTTCAGGCTGGATGTATTGTAGGTTTCTGTAATCCTAGCGCTGAGGAGGCAGA
AGCAGGAGGAGTTCAAGGTTAAGGCCAGCCTGAGGATCATGGGAAGTTCCAGACCAGTCTGGCTAAACGTAATAAAGGTG
TGACAGGCATACTTTANAGGACAGTCTGTATTACATANTCTGGGCTGCAAGGTAANACCTGTCTCAAAAAAANCNNCNNC
ANATGATNCCNTTTCTGACTANAGAGAAAGAGAGAAGGTTTCTTTCTAGAAAGAGAGGCTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI5281

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 88660208..88660511 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021036 (Sptlc2) NM_011479 serine palmitoyltransferase, long chain base subunit 2 Gene [Source:MGI Symbol;Acc:MGI:108074]


Sequence tag IST10750A7BBF1
Sequence
ATCNGATGAAGTCTTTAAGCTGCCATCACATTACTGGCTCAACACACTGAATTCTAACAAGCATAAGACACCAGCTATTG
CAAGCATTTAAGACTATTCCATCGAATCTGTTAGCTCAGTTTCCGTCCCAAAGTTTGAGCAAGTTATTTCAGACAGACTC
AAATAAACNTGGACTTCCAGGACAGATATATATTACACCTAATTCTTAACCCTTGCTGTCTCANANAGAACACAGATGTG
GGCCTGGAGAGACAGCTCAGTGGTTGANAGTACTTGCTGCTCCTAACNNAGGACCCNAGCAGGGGGTTTGCTANCCCCCA
NATNANANAACTCNNAACTATCCCATATCTTCAACTNCNNGGTATCTGATGGCCTCTTCTGACCTCCTCANGCTNCCAAN
CTNANNNNNNATANNCNNNNAAACATATAAAATTAACGTTNANACCNTGACN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000021036


For any suggestions or comments, please send an email to unitrap@crg.es