Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14878E5
Clone ID IST14878E5
Vector VICTR76
Project tigm

Sequence tag IST14878E5HMR1
Sequence
AACTAACTGGTGGGAGTCGCTTGAGTCTGCAGGGACAAGAGGGACAGCCCTGAGATGTGGGACCACTTCTCCCAGCAGGG
ATGTCAGATAAGAGTACCTGCTGTGCANAGATCCAGACCTGAGTTCAGATCTCTAGAACCTGTGTGGNGN
Sequence Type genomic DNA
Unitrap ID UNI23735

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123083085..123083231 145
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]


Sequence tag IST14878E5HMF1
Sequence
AGTTGTGGGGGTGGGTGTTAAGAAACAAGAAATAAACCCAACCAACACTACATCCCAACCACTGCCCGGGCACCATGAGG
AACTGGCAGCGAAGGGGACCTAGGACCAAGGGCACAGTGACAAACACCAGGCAGGGAAGTGCTCTGGAGCCCCCAGAGTG
TAGCACAAATAGCCAGGCGTGCAGCAGGAAGTTCCAGCAGAGGTATCCGCCATGATATGCAGCTTTGAGGAGACAGTGAA
ACTGAACCACGGGGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123082832..123083088 257
NO GENE  


Sequence tag IST14878E5BBF1
Sequence
AGTTGTGGGGGTGGGTGTTAAGAAACAAGAAATAAACCCAACCAACACTACATCCCAACCACTGCCCGGGCACCATGAGG
AACTGGCAGCGAAGGGGACCTAGGACCAAGGGCACAGTGACAAACACCAGGCAGGGAAGTGCTCTGGAGCCCCCAGAGTG
TAGCACAAATAGCCAGGCGTGCAGCAGGAAGTTCCAGCAGAGGTATCCGCCATGATATGCAGCTTTGAGGAGACAGTGAA
ACTGAACCACGGGGTGGCCATATGCTGCCGGACAGGACTCTTCTCCTGCTCTGCCANTGTGTCTTCACGCATGTCACAGG
TCTGGANGCTGGGTGGCCTCANTGTCCATCCGCGAGGGAACGGGGCTGGTGGNNGTGCNGNTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123082711..123083088 368
NO GENE  

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es