Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A041A01
Clone ID A041A01
Vector pT1betageo
Project ggtc

Sequence tag A041A01
Sequence
ACATATCCATGGTGGTGTCAGGCTTGACCCCCAAAGAAGTAATGACCGTGCAAAAGTTTGCTGAAAAATACCGCCTCACT
TTAACTGACGCAATTACTGAGGAGACTACACATGTAATTATAAAAACAG
Sequence Type mRNA
Unitrap ID UNI12098

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101366631..101369304 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es