Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14673A6
Clone ID IST14673A6
Vector VICTR74
Project tigm

Sequence tag IST14673A6HMF2
Sequence
TTAGTCGTTCCTCCTCATCCCTGTTTTTTCCNCAGCCTATTGAGCTAAN
Sequence Type genomic DNA
Unitrap ID UNI15587 UNI15589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166328: 29253..29298 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166344: 253358..253403 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161911: 170464..170509 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 4538628..4538673 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 54045785..54045830 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 25522070..25522115 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55707271..55707316 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3508180..3508225 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 52080476..52080521 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 19314922..19314967 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 11822357..11822402 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 50227625..50227670 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 30626215..30626260 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 15760013..15760058 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115778493..115778538 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030321 (BC060267) NP_001103976  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 20935805..20935850 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 60341422..60341467 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 19082778..19082823 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7567238..7567283 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 21201773..21201818 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 15121367..15121412 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7470862..7470907 44
NO GENE  


Sequence tag IST14673A6BBF1
Sequence
TTAGTNGNNNCNCCNNNNCCCTGTTTTTTCCNCAGCCTATTGAGCTAAGGACACCTTGCANTANCNGCAAGGGTGAAAAG
CCAGAGGTCAGCTAAGGGGCTAAGCCTGTCTATCAAAATAAAAACCAATCTTTATTAATATAGAAATATCTACTCTTCTA
GCCCTCTAGGTAAACCTAAATTTTTAACTCAGACTGAAAACCACGTGCTGGAAATGTCCTGAGACTGGGGGTAACAGCTG
CCACCTGTGTGCTCTAGGGGGGCGGGGATGTACATCCACTGCTCCGCCTCGAGAATGTTGATTTACCTGCTTGAAAGACN
AAATCTTGAANGACANTNNNAAANTNNGAAAGCAAANCTTCTTTTGGGNAACTCTAGGTNNNNTATTTAAATGCNNNCTG
NNAAGCTGANGCTANTCNCCNGCNNNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14673A6HMR1
Sequence
TTCCAGCTCCTATTTTAGCNNCAAATCGTGGTGTTACTAACGACATAATTCTTGCTTAGGCTTTGCTAATCCTGAGGTTG
ATAATTCTCCTTTAGGAGCTGCACAGCACTCAGAACTGTGCATACTGGTTTGTGATTGTACAAATTCAGTATGGGCACCG
CTTGGTGCAGAACTACTGCAAGGGAAGGTCCAGCTTGACCATTTCTGAGTTTCCTGTGAGATAAACCCGGTTTAAAAGAG
GTTGGTATCATATTTTGGTTAAAAATAAAAAATATTTTCCGGCTCTACCTCGCCTCCCCAAAAGATACCNANAGCCACAT
GTGTGGGTTTNACCNNTACCCACGGGAGGAATCNGGTCCNTGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7470907..7471268 344
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 7567283..7567644 344
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136941633..136941994 344
 
EST/CDNA Est Name
  BE854950.1 - BI789805.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 115778538..115778899 344
 
EST/CDNA Est Name
  BQ892144.1 - CJ047500.1

 
Come back to gene BQ892144.1 - CJ047500.1


For any suggestions or comments, please send an email to unitrap@crg.es