Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12640C8
Clone ID IST12640C8
Vector VICTR76
Project tigm

Sequence tag IST12640C8BBF1
Sequence
CAGGAACCACATGGTGGCTCACAACCACCGGTAATGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI3452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4702576..4702618 43
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000009073 (Nf2) NM_010898 neurofibromatosis 2 Gene [Source:MGI (curated);Acc:Nf2-001]


Sequence tag IST12640C8HMF1
Sequence
CAGGAACCACATGGTGGCTCACAACCACCGGTAATGAGATCTGACGCCCTCTTCTGGTGTCTGAAGACAGCTACAGTGTA
CTTATGTATAACAATAAATAAACATCTTAAAAAAAACTTTAAAAACAAAACAAAAAACAAACAAACAAACAAAAAAACCA
GGGCACACTGAAATGTACTACCACAATAANCAAGGGCCTAAAAAATATTTTACTTGTACCAGGACCTGAGTTCAAGTCCC
ANCTCGTGGTTTGGGAGGCTCACAATTGCCNGANATTCCNNCTCCNGGGNANCNGAGGCCTGTGGATTCTGAGGNCACNT
GCNCTNANGTGCNCNNACACNGAAATACNTNNNTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000009073


For any suggestions or comments, please send an email to unitrap@crg.es