Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone A042C03
Clone ID A042C03
Vector pT1betageo
Project ggtc

Sequence tag A042C03
Sequence
GTTTTACAGAAACCGTCAGTGTTTGGGAGTGATTCTGATGACGATGAGACTTCCGTGAGCGNNNGCCTTCAGAGGGAAGC
TGCTAAGAAGCAGGCCATGAAACAGACCAAATTGGAGATTCAGAAAGCTCTTGCAGAAGACTCCACTGTGTATGAGTATG
ACAGCGTTTATGATGAGATGCAGAAAAAGAAGGAAGAAAACAACCCCAAGCTGCTTCCGGGGAAGGATCGGAAGCCCAAA
TATATTCACAACTTACTAAAAGCAGTCGAGATCAGGAAAAAGGAGCAGGAAAAGAGAATGGAAAAGAAAATACAGAGAGA
ACGAGAGATGGAAAACGGAGAATTTGATGATAAAGAGGCATTTGTGACATCTGCTTATAAAAAGAAACTTGAAGAGAGAG
CTGAAGAGGAGGAAAGAGAAAAGAGGGCAGCTGNNCTGGAAG
Sequence Type mRNA
Unitrap ID UNI12106

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 76862775..76890203 206
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037958 (Ccdc55) NM_001012309 coiled-coil domain containing 55 Gene [Source:MGI (curated);Acc:Ccdc55-001]

 
Come back to gene ENSMUSG00000037958


For any suggestions or comments, please send an email to unitrap@crg.es