Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14984G3
Clone ID IST14984G3
Vector VICTR76
Project tigm

Sequence tag IST14984G3BBF1
Sequence
CTGTTACTGCTTTCTTTGCCTGTTGGCTTAAGGGCATCAGAAGCCCAAAGAGGCCATGGGAAAGTCTGAGCTTCCACTTC
AGTGTAATGTTTGTTGTGGCTCCTGGCAGGAGCACTTGCCCCTCTGGAACCAAAACTTCTAGGGCAGCAGAACCTAAGGT
CTTGAGAACAAGAAGCAAGAATTTTCCTAGTGGTTCCTAGGGGCGATAGTGTGTGAAACTATTTCCTCTTTTGCTCCTTG
ATTCCTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54044898..54045148 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004633 (Chn2) NM_023543 chimerin (chimaerin) 2 Gene [Source:MGI (curated);Acc:Chn2-001]


Sequence tag IST14984G3HMR1
Sequence
ACAGTGTTAGGAGGGGTGATTGATCCAGATACCAAAGGAAAATTGACTGCTTCTCCACAATGGAGGTAAGGAGGATTAAG
ACTGGATTGAGGGAGCTGCTTTAGGGCATCGCTCAGTGCTGCCATGTCCTGTGATTAAAGTCATTGGGAAACCATAGCAG
CCTAACTCAGGCAGGATCACAAAGGGCACTGACCCAGCAGGAATGAAGGTATGGGTGAGTCCTCCANGAAAAGAGCTAAN
ACCTTCTGANGTGCTTACNNAGGGTGAAGAAAATGCANAATGGGCANTANANGGANGTANTTNNNNNTACCACCANCTGC
ACAATCCATTAATTATCANCNACATGACTGTTTCTGTCANATTTCCTTANNANTGTGTGTNNACNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14984G3HMF1
Sequence
CTGTTACTGCTTTCTTTGCCTGTTGGCTTAAGGGCATCANAAGCCCAAAGAGGCCATGGGAAANTCTGANCTTCCACTTC
N
Sequence Type genomic DNA
Unitrap ID UNI16292

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 54044898..54044977 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000004633 (Chn2) NM_023543 chimerin (chimaerin) 2 Gene [Source:MGI (curated);Acc:Chn2-001]

 
Come back to gene ENSMUSG00000004633


For any suggestions or comments, please send an email to unitrap@crg.es