Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14899D8
Clone ID IST14899D8
Vector VICTR76
Project tigm

Sequence tag IST14899D8HMF2
Sequence
ATACCTTCTTCTGGCATTCAGGTGTACATGCAGCAAAGCATGCATGCAATAAATTTAAAAAAGGAAGGAAGGAAAGAAAG
AAAGAAATTGGCAAGTATACATCACATACAGTAGGTAGTAAAGTCCTATGTGAGCCAATTATGACTGCACACAGTGGGCT
CAGGCAGGACTAGGTAGATGGGAAGGAGGAAGAGGATGACACACAGCAACAAAGGCAACACTGCTACCTTCCTGTTCCCG
GGGGTTACCCTGTACACCTTTCAATTATGCTGAGCTGTTAAGAGATCCACACTGAGACCTGGTCTGAAATCTTTGTCCAG
CTTTGGGTGACTGAAGTTCACCTATTCCTCTCTCACAGGAGAGTANTCNAGGCTGTACATGTGGCAGGGTCCACNNANNN
NANCCNTGCTGGAANACTCTGCTTN
Sequence Type genomic DNA
Unitrap ID UNI32849

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18321965..18322388 402
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013539 (D16H22S680E) NM_138583 Ser/Thr-rich protein T10 in DGCR region [Source:UniProtKB/Swiss-Prot;Acc:P54797]

 
Come back to gene ENSMUSG00000013539


For any suggestions or comments, please send an email to unitrap@crg.es