Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone G022B11
Clone ID G022B11
Vector U3CEO
Project ggtc

Sequence tag G022B11
Sequence
CAAGATGAAGGAGCCTCTTGCTTCTTACTTGGGTGACACAATGAACTGTGCCTCCATCCCGGAAGATGTGCTCTATATTG
ATGGACAGGCTCGGTACAGTCACTCCGGCCAGGTGGTGATCTCCAGGATGGAGGAGGGGGAGGTCACCATTTTTCAGACC
CTCATTGGAGAGCAGATCGGGTCGCACCGGGGTGGGGTGTTNNNCACTATTTACA
Sequence Type mRNA
Unitrap ID UNI12113

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 115787129..115791778 102
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042284 (Itga1) NM_001033228 integrin alpha 1 Gene [Source:MGI Symbol;Acc:MGI:96599]

 
Come back to gene ENSMUSG00000042284


For any suggestions or comments, please send an email to unitrap@crg.es